bioinformatics - Star index generation - 'std::bad_alloc' error

Question

I was trying to generate a genome index using STAR index for mutant library 99,50 hours post fertilization (99H50) with the annotation form Lawson lab. The code I used is as follows:

module load STAR; STAR --runThreadN 10 --runMode genomeGenerate --genomeDir /gpfs/ysm/scratch60/polimanti/ag2646/99H50_new_annotation/z10starindex75/ --genomeFastaFiles /gpfs/ysm/scratch60/polimanti/ag2646/Lawsonreference/genome.fa --sjdbGTFfile /gpfs/ysm/scratch60/polimanti/ag2646/Lawsonreference/genes.gtf --sjdbOverhang 75
the batch script used to submit the job for creation of such indices is 
dsq --job-file z10starindex75.txt --job-name z10starindex75 -c 10 --mem=100G -t 10:00:00 --mail-type=ALL [email protected]

I tried to run this code on my HPC cluster and it throws me an error as follows:

Jan 22 22:41:39 ..... started STAR run
Jan 22 22:41:39 ... starting to generate Genome files
Jan 22 22:42:04 ... starting to sort Suffix Array. This may take a long time...
Jan 22 22:42:09 ... sorting Suffix Array chunks and saving them to disk...
Jan 22 22:47:18 ... loading chunks from disk, packing SA...
Jan 22 22:47:42 ... finished generating suffix array
Jan 22 22:47:42 ... generating Suffix Array index
Jan 22 22:49:38 ... completed Suffix Array index
Jan 22 22:49:38 ..... processing annotations GTF
terminate called after throwing an instance of 'std::bad_alloc'

      what():  std::bad_alloc
    /bin/sh: line 1: 186783 Aborted                 STAR --runThreadN 10 --runMode genomeGenerate --genomeDir /gpfs/ysm/scratch60/polimanti/ag2646/99H50_new_annotation/z10starindex75/ --genomeFastaFiles /gpfs/ysm/scratch60/polimanti/ag2646/Lawsonreference/genome.fa --sjdbGTFfile /gpfs/ysm/scratch60/polimanti/ag2646/Lawsonreference/genes.gtf --sjdbOverhang 75

---

I Googled and found out that such errors might originate from the allocation of memory and hence I ran from the space in the cluster where I have enough space.

The memory usage for such job has been given by Job ID:

47861791 Array Job ID: 47861791_0

---

Cluster: farnam User/Group: ag2646/nicoli State: FAILED (exit code 134)
Nodes: 1 Cores per node: 10 CPU Utilized: 00:36:34 CPU Efficiency: 45.14% of 01:21:00 core-walltime Job Wall-clock time: 00:08:06 Memory Utilized: 25.64 GB Memory Efficiency: 25.64% of 100.00 GB.

---

I browsed the internet and tried to find out solutions.

1. I tried to reduce the number of threads from 10 to 1 to reduce the computational memory issue.
2. I tried to use allocate specific memory limits by using flags like:

    `limitGenomeGenerateRAM` 
    
        48000000000
        (3) --genomeChrBinNbits 16
        Still the error is creeping in.
        First few lines of my GTF file is chr12   UMMS    gene    6160446 6177944 .       -       .       gene_id "LL0000000001"; gene_name "a1cf";
    
    chr12   UMMS    exon    6160446 6161260 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6163727 6163869 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6165086 6165222 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6165305 6165498 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6167117 6167396 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6168940 6169037 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6169982 6170146 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6170412 6170650 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";
    chr12   UMMS    exon    6170731 6170861 .       -       .       gene_id "LL0000000001"; gene_name "a1cf"; transcript_id "ENSDART00000152292";

Some of the lines of the genome fasta file is as follow:

chr1
gatcttaaacatttattccccctgcaaacattttcaatcattacattgtc
atttcccctccaaattaaatttagccagaggcgcacaacatacgacctct
aaaaaaggtgctgtaacatgtacctatatgcagcaccactatatgagagc
ggcatagcagtgtttagtcacttggttgctttgtttatattaacttgaaa
gtgtgttttagctattgagtttaaacaaagggagcggtttacattgaatt
aaaggcaactactgatgggttgtgtaatgtttcaaagagctgttgcagca
tgagtggaaaataaaaccgtattagtgctgcctggcccagtttggcacaa
aatggagcgattccattaagagaacgattcagcataagtggaacagcTAA
AGtttatgaaaatttttaatctggatgtagagaatctcataacacagaaa

I have tried to provide as much detail as possible and any help will be helpful.

question from:https://stackoverflow.com/questions/65866214/star-index-generation-stdbad-alloc-error

Answer 1

Waitting for answers